ID: 1085731372_1085731382

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1085731372 1085731382
Species Human (GRCh38) Human (GRCh38)
Location 11:79001969-79001991 11:79001989-79002011
Sequence CCCATAGCTCCCCATCTCCCCTG CTGCTTTTCTGGTGCATCCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 52, 4: 458} {0: 1, 1: 0, 2: 0, 3: 13, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!