ID: 1085769019_1085769029

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1085769019 1085769029
Species Human (GRCh38) Human (GRCh38)
Location 11:79308738-79308760 11:79308790-79308812
Sequence CCAGGCCATGCCACCCACTCTGC GAACAATCATTTCACTTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 50, 4: 412} {0: 1, 1: 0, 2: 1, 3: 40, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!