ID: 1085769022_1085769030

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1085769022 1085769030
Species Human (GRCh38) Human (GRCh38)
Location 11:79308751-79308773 11:79308791-79308813
Sequence CCCACTCTGCAGAGCCACCTCCT AACAATCATTTCACTTCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 351} {0: 1, 1: 0, 2: 10, 3: 71, 4: 500}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!