ID: 1085969735_1085969741

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1085969735 1085969741
Species Human (GRCh38) Human (GRCh38)
Location 11:81573450-81573472 11:81573477-81573499
Sequence CCAAAAAAAAAAAATTTAAATCA TACTGGGGCCAGAGGGAAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 51, 4: 478}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!