ID: 1086096275_1086096284

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1086096275 1086096284
Species Human (GRCh38) Human (GRCh38)
Location 11:83053061-83053083 11:83053083-83053105
Sequence CCTCCCCTAACTATCATGAATCC CCCTGGGCTCCATAGATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59} {0: 1, 1: 0, 2: 0, 3: 16, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!