ID: 1086119024_1086119036

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1086119024 1086119036
Species Human (GRCh38) Human (GRCh38)
Location 11:83286311-83286333 11:83286363-83286385
Sequence CCCCAAGATAGCCAGCGGCCATT CATTTAGCCGCACAGCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47} {0: 1, 1: 0, 2: 1, 3: 6, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!