ID: 1086243080_1086243083

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1086243080 1086243083
Species Human (GRCh38) Human (GRCh38)
Location 11:84720039-84720061 11:84720062-84720084
Sequence CCGAGCTGCATCTGCTCTTGTAG CCTCTGTATGTTAGAGACCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 155} {0: 1, 1: 0, 2: 3, 3: 20, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!