ID: 1086259608_1086259616

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1086259608 1086259616
Species Human (GRCh38) Human (GRCh38)
Location 11:84923381-84923403 11:84923432-84923454
Sequence CCTCAGTTGCTTTTCCTTCTAGC AAGAAGAAGAAGAAGGAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 302} {0: 2, 1: 21, 2: 235, 3: 1173, 4: 4821}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!