|
Left Crispr |
Right Crispr |
Crispr ID |
1086265939 |
1086265945 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:84998235-84998257
|
11:84998256-84998278
|
Sequence |
CCAGGTGTCAAGGGCAGGACCAG |
AGGTGGAGGTAATCGGATTATGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 120, 2: 389, 3: 760, 4: 1696} |
{0: 1, 1: 23, 2: 266, 3: 904, 4: 2531} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|