ID: 1086265939_1086265945

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1086265939 1086265945
Species Human (GRCh38) Human (GRCh38)
Location 11:84998235-84998257 11:84998256-84998278
Sequence CCAGGTGTCAAGGGCAGGACCAG AGGTGGAGGTAATCGGATTATGG
Strand - +
Off-target summary {0: 3, 1: 120, 2: 389, 3: 760, 4: 1696} {0: 1, 1: 23, 2: 266, 3: 904, 4: 2531}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!