ID: 1086278611_1086278614

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1086278611 1086278614
Species Human (GRCh38) Human (GRCh38)
Location 11:85160428-85160450 11:85160462-85160484
Sequence CCATCTTCTGCAGATAAGTACTC AACAGCTCTTGGCCTGTTATTGG
Strand - +
Off-target summary {0: 3, 1: 192, 2: 190, 3: 136, 4: 294} {0: 1, 1: 19, 2: 193, 3: 220, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!