ID: 1086281969_1086281975

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1086281969 1086281975
Species Human (GRCh38) Human (GRCh38)
Location 11:85200516-85200538 11:85200551-85200573
Sequence CCCAGTCTCAGCATCAGCCCCTT GAGAACTACCCCATCTATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 23, 4: 311} {0: 1, 1: 0, 2: 1, 3: 12, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!