ID: 1086303232_1086303240

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1086303232 1086303240
Species Human (GRCh38) Human (GRCh38)
Location 11:85452551-85452573 11:85452595-85452617
Sequence CCTCCAACACCATAACTAGAATG ATTGTCATATCAGGCCATCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 149} {0: 1, 1: 0, 2: 1, 3: 4, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!