ID: 1086323825_1086323828

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1086323825 1086323828
Species Human (GRCh38) Human (GRCh38)
Location 11:85678208-85678230 11:85678221-85678243
Sequence CCTACACCAGTTCTGAAGTCAGC TGAAGTCAGCCTCTCCTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 177} {0: 1, 1: 1, 2: 1, 3: 32, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!