ID: 1086354463_1086354469

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1086354463 1086354469
Species Human (GRCh38) Human (GRCh38)
Location 11:85980209-85980231 11:85980234-85980256
Sequence CCTTGGTTCAGCTCTCATACCAG CAGAGGATAGAGAAGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 118} {0: 1, 1: 0, 2: 5, 3: 149, 4: 1367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!