ID: 1086399532_1086399536

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1086399532 1086399536
Species Human (GRCh38) Human (GRCh38)
Location 11:86449072-86449094 11:86449104-86449126
Sequence CCCCATATGGAACAATAGGAAGC CTGAGGATCTCTGCCATTCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 179} {0: 1, 1: 0, 2: 1, 3: 16, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!