ID: 1086409968_1086409973

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1086409968 1086409973
Species Human (GRCh38) Human (GRCh38)
Location 11:86535251-86535273 11:86535300-86535322
Sequence CCTACCTTCATCTGTTCTTCCAG TCACATCTATGTCGTCCACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 393} {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!