ID: 1086420350_1086420355

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1086420350 1086420355
Species Human (GRCh38) Human (GRCh38)
Location 11:86632185-86632207 11:86632227-86632249
Sequence CCAAAAGTGATGTGTTCAAGGGC CAGCCTGAGCAGAGGGCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 482} {0: 1, 1: 0, 2: 5, 3: 47, 4: 423}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!