ID: 1086437978_1086437986

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1086437978 1086437986
Species Human (GRCh38) Human (GRCh38)
Location 11:86800457-86800479 11:86800471-86800493
Sequence CCCGAGGCCGGAGGCGGGGCGGG CGGGGCGGGCGGGCCTCGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 81, 4: 606} {0: 1, 1: 0, 2: 1, 3: 70, 4: 574}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!