|
Left Crispr |
Right Crispr |
Crispr ID |
1086473739 |
1086473743 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:87147061-87147083
|
11:87147074-87147096
|
Sequence |
CCAGTAATCCCAGCACTCTGGGA |
CACTCTGGGAAGCCGAGACAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 7643, 1: 296201, 2: 259723, 3: 149283, 4: 132738} |
{0: 1, 1: 2, 2: 77, 3: 979, 4: 3116} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|