ID: 1086473739_1086473743

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1086473739 1086473743
Species Human (GRCh38) Human (GRCh38)
Location 11:87147061-87147083 11:87147074-87147096
Sequence CCAGTAATCCCAGCACTCTGGGA CACTCTGGGAAGCCGAGACAGGG
Strand - +
Off-target summary {0: 7643, 1: 296201, 2: 259723, 3: 149283, 4: 132738} {0: 1, 1: 2, 2: 77, 3: 979, 4: 3116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!