ID: 1086486071_1086486075

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1086486071 1086486075
Species Human (GRCh38) Human (GRCh38)
Location 11:87303351-87303373 11:87303371-87303393
Sequence CCAGCCACCCAGTCAGTGGAAAA AAAATTCTCTTCCGTGAAACCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 17, 3: 65, 4: 369} {0: 1, 1: 28, 2: 484, 3: 750, 4: 1071}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!