ID: 1086556492_1086556497

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1086556492 1086556497
Species Human (GRCh38) Human (GRCh38)
Location 11:88117268-88117290 11:88117305-88117327
Sequence CCTGACTGAGCTTACCTACTAGC TAGCAAAAGCATAAAAAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 53, 4: 896} {0: 1, 1: 0, 2: 0, 3: 30, 4: 354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!