ID: 1086611195_1086611201

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1086611195 1086611201
Species Human (GRCh38) Human (GRCh38)
Location 11:88757810-88757832 11:88757834-88757856
Sequence CCTACAAAATGCTTTGGCACCTC CATTGATGTTTAGGGACCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 106} {0: 1, 1: 0, 2: 2, 3: 16, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!