ID: 1086643291_1086643297

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1086643291 1086643297
Species Human (GRCh38) Human (GRCh38)
Location 11:89186730-89186752 11:89186761-89186783
Sequence CCAAAAATGTGTGTGTTGAATCC CAGTGTGACTATTTGGAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 39, 3: 146, 4: 799} {0: 1, 1: 2, 2: 17, 3: 36, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!