ID: 1086728777_1086728790

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1086728777 1086728790
Species Human (GRCh38) Human (GRCh38)
Location 11:90222751-90222773 11:90222804-90222826
Sequence CCAAGGGAGGCCCAGGAGGGGCA GGAGATCCGCGGACACCCTCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 78, 4: 531} {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!