ID: 1087012883_1087012885

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1087012883 1087012885
Species Human (GRCh38) Human (GRCh38)
Location 11:93530029-93530051 11:93530075-93530097
Sequence CCTGCTGACCAGGAGAGCTGACT TTTTATACACAGAAGAATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 206} {0: 1, 1: 0, 2: 1, 3: 23, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!