ID: 1087175358_1087175363

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1087175358 1087175363
Species Human (GRCh38) Human (GRCh38)
Location 11:95090413-95090435 11:95090450-95090472
Sequence CCTGTCGAGCTACAATAAGAGCC CCTTCACTTCATGAGCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 22} {0: 1, 1: 0, 2: 0, 3: 15, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!