ID: 1087266941_1087266948

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1087266941 1087266948
Species Human (GRCh38) Human (GRCh38)
Location 11:96071031-96071053 11:96071061-96071083
Sequence CCTTCCCTCTAGATATTTACATG AGGGGCCTTCTGAGTGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 260} {0: 1, 1: 0, 2: 6, 3: 31, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!