ID: 1087291579_1087291584

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1087291579 1087291584
Species Human (GRCh38) Human (GRCh38)
Location 11:96326478-96326500 11:96326504-96326526
Sequence CCCTTTGCTGAAAGTCTTAAAAA TCTCGAGTTTAGGCTGGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 457} {0: 1, 1: 0, 2: 3, 3: 39, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!