ID: 1087564067_1087564071

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1087564067 1087564071
Species Human (GRCh38) Human (GRCh38)
Location 11:99831282-99831304 11:99831326-99831348
Sequence CCTGGTTGTGGAAGTGTTTTTCC TTAACGAAGTGGTAGTTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 11, 4: 169} {0: 1, 1: 2, 2: 29, 3: 76, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!