ID: 1087652704_1087652706

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1087652704 1087652706
Species Human (GRCh38) Human (GRCh38)
Location 11:100886984-100887006 11:100887036-100887058
Sequence CCATGGACATGATACTGTGCTGA ATGCATGTCAGTACTCAGGATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 12, 4: 163} {0: 1, 1: 0, 2: 2, 3: 15, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!