ID: 1087755164_1087755167

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1087755164 1087755167
Species Human (GRCh38) Human (GRCh38)
Location 11:102047532-102047554 11:102047547-102047569
Sequence CCTTCCAGTCTCTGAGCTCTAAG GCTCTAAGGAGATCACCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 284} {0: 1, 1: 0, 2: 1, 3: 4, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!