ID: 1087849179_1087849182

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1087849179 1087849182
Species Human (GRCh38) Human (GRCh38)
Location 11:103009176-103009198 11:103009223-103009245
Sequence CCTGCATTCTGCAGGGTGCATCT TGAGAGCCTGTGACATTTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 35, 3: 388, 4: 1651}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!