ID: 1087876281_1087876285

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1087876281 1087876285
Species Human (GRCh38) Human (GRCh38)
Location 11:103361872-103361894 11:103361919-103361941
Sequence CCGAATAGCTTCTGAGAGGTTAA CTGGATATTCAGAATAAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 163} {0: 1, 1: 0, 2: 1, 3: 28, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!