|
Left Crispr |
Right Crispr |
Crispr ID |
1087942695 |
1087942700 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:104118253-104118275
|
11:104118274-104118296
|
Sequence |
CCTCATGAATGGAATTAGTCCCC |
CCTTATAAGAAGAGACACAAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 76, 2: 650, 3: 1471, 4: 2310} |
{0: 3, 1: 19, 2: 49, 3: 114, 4: 395} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|