ID: 1088162212_1088162214

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1088162212 1088162214
Species Human (GRCh38) Human (GRCh38)
Location 11:106886077-106886099 11:106886092-106886114
Sequence CCTTCTTGATCACAAGAGAGCCA GAGAGCCACCACTATTAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113} {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!