ID: 1088162233_1088162241

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1088162233 1088162241
Species Human (GRCh38) Human (GRCh38)
Location 11:106886269-106886291 11:106886322-106886344
Sequence CCTTCCTGTTAATTGGAATGCAT GGGCAATGGGGAAAAGTTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 187} {0: 1, 1: 0, 2: 3, 3: 42, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!