ID: 1088254058_1088254059

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1088254058 1088254059
Species Human (GRCh38) Human (GRCh38)
Location 11:107886510-107886532 11:107886529-107886551
Sequence CCTTATTTGGAAATAGGGTCTAT CTATGAGAATGTAATCAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 288, 2: 980, 3: 1683, 4: 2159} {0: 1, 1: 0, 2: 2, 3: 34, 4: 583}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!