ID: 1088303748_1088303750

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1088303748 1088303750
Species Human (GRCh38) Human (GRCh38)
Location 11:108386600-108386622 11:108386615-108386637
Sequence CCTTCTGTGAGGATGATGGAAAA ATGGAAAAGCACCAAGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 246} {0: 1, 1: 0, 2: 2, 3: 37, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!