ID: 1088330910_1088330918

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1088330910 1088330918
Species Human (GRCh38) Human (GRCh38)
Location 11:108650497-108650519 11:108650541-108650563
Sequence CCAGCCTGGGTAACAGAGTGAGA AAAAAAAAGGAGCAGGAGGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!