ID: 1088334156_1088334162

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1088334156 1088334162
Species Human (GRCh38) Human (GRCh38)
Location 11:108685137-108685159 11:108685177-108685199
Sequence CCCATGTTGTAGGTTGCCTGTTC CAGCGCGATTCCGTGGGCGTAGG
Strand - +
Off-target summary {0: 1123, 1: 5178, 2: 10488, 3: 6685, 4: 5403} {0: 16, 1: 450, 2: 786, 3: 859, 4: 831}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!