ID: 1088461825_1088461831

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1088461825 1088461831
Species Human (GRCh38) Human (GRCh38)
Location 11:110091429-110091451 11:110091468-110091490
Sequence CCTGCCTACCTGCAATTTTATTT GGCCTACTGACGTGGAAAACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!