ID: 1088470587_1088470596

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1088470587 1088470596
Species Human (GRCh38) Human (GRCh38)
Location 11:110184563-110184585 11:110184599-110184621
Sequence CCCTTCTGATGGGGGTGGGAGGC TGGAGATGGGAAAGTCCTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 35, 4: 318} {0: 1, 1: 0, 2: 0, 3: 23, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!