ID: 1088585581_1088585586

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1088585581 1088585586
Species Human (GRCh38) Human (GRCh38)
Location 11:111357660-111357682 11:111357686-111357708
Sequence CCTCCTCTGTCACTGCAGACACA CCTTCCATGTCCAGGCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 426} {0: 1, 1: 0, 2: 2, 3: 22, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!