ID: 1088588382_1088588386

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1088588382 1088588386
Species Human (GRCh38) Human (GRCh38)
Location 11:111379593-111379615 11:111379627-111379649
Sequence CCAAAAGCTCCTCTGGAAAACGT CGGCGCCCATGCAGGCTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 136} {0: 1, 1: 0, 2: 1, 3: 4, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!