ID: 1088625492_1088625500

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1088625492 1088625500
Species Human (GRCh38) Human (GRCh38)
Location 11:111727470-111727492 11:111727501-111727523
Sequence CCCAACTCTGGTGCTGGAGTAAT CTGCATTTTGATGGGGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 189} {0: 1, 1: 0, 2: 2, 3: 16, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!