ID: 1088751554_1088751561

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1088751554 1088751561
Species Human (GRCh38) Human (GRCh38)
Location 11:112846432-112846454 11:112846476-112846498
Sequence CCTCTCTGGAGAGCCCTGACTAG ATGGTTAGACAGCTTCCAGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!