ID: 1088765031_1088765033

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1088765031 1088765033
Species Human (GRCh38) Human (GRCh38)
Location 11:112966666-112966688 11:112966706-112966728
Sequence CCATTATGCCTTTTCATTTCATG CTCAGCTGCAGATGCTCATTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 40, 4: 436} {0: 1, 1: 0, 2: 2, 3: 20, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!