ID: 1088766881_1088766884

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1088766881 1088766884
Species Human (GRCh38) Human (GRCh38)
Location 11:112990476-112990498 11:112990501-112990523
Sequence CCATTTCAGGGTTTTTTGTGGGA GAGGTCAGCAACCCTGCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 264} {0: 1, 1: 0, 2: 4, 3: 23, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!