ID: 1088779065_1088779073

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1088779065 1088779073
Species Human (GRCh38) Human (GRCh38)
Location 11:113116327-113116349 11:113116362-113116384
Sequence CCTTCATTATAGAAGGGAAAGAG CTGGTAGTGCCAGGGCTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 238} {0: 1, 1: 0, 2: 3, 3: 32, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!