ID: 1088820147_1088820151

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1088820147 1088820151
Species Human (GRCh38) Human (GRCh38)
Location 11:113449560-113449582 11:113449609-113449631
Sequence CCTGAGCACATGCCATCATAGGT ATGCTGGGCTAGCAGAGTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 92} {0: 1, 1: 0, 2: 2, 3: 19, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!